Fix pressing submit button not submitting results for processing

.github/workflows/code-qa.yaml → .github/workflows/code-qa-js.yaml

@@ -1,17 +1,40 @@
-# This workflow will do a clean install of node dependencies, build the source code and run tests across different versions of node
-# For more information see: https://help.github.com/actions/language-and-framework-guides/using-nodejs-with-github-actions
-
-name: Code Quality Assurance
+name: Code Quality Assurance - JavaScript/TypeScript
 
 on:
     push:
         branches: [master]
-        paths-ignore:
-            - "core/scripts/APIandLibraries/**"
+        paths:
+            - "**/*.js"
+            - "**/*.ts"
+            - "**/*.mjs"
+            - "**/*.html"
+            - "**/*.css"
+            - "**/*.json"
+            - "**/*.xml"
+            - "**/*.svg"
+            - "**/*.png"
+            - "**/*.webp"
+            - "**/*.ico"
+            - ".prettierrc"
+            - ".github/workflows/code-qa-js.yaml"
+            - "package*.json"
     pull_request:
         branches: [master]
-        paths-ignore:
-            - "core/scripts/APIandLibraries/**"
+        paths:
+            - "**/*.js"
+            - "**/*.ts"
+            - "**/*.mjs"
+            - "**/*.html"
+            - "**/*.css"
+            - "**/*.json"
+            - "**/*.xml"
+            - "**/*.svg"
+            - "**/*.png"
+            - "**/*.webp"
+            - "**/*.ico"
+            - ".prettierrc"
+            - ".github/workflows/code-qa-js.yaml"
+            - "package*.json"
 
 permissions:
     contents: read
@@ -26,13 +49,13 @@ jobs:
 
         steps:
             - name: Checkout repository
-              uses: actions/checkout@v5
+              uses: actions/checkout@v6
             - name: Use Node.js ${{ matrix.node-version }}
               uses: actions/setup-node@v6
               with:
                   node-version: ${{ matrix.node-version }}
             - name: Cache Node.js modules
-              uses: actions/cache@v4
+              uses: actions/cache@v5
               with:
                   path: ~/.npm
                   key: ${{ runner.os }}-node-${{ hashFiles('**/package-lock.json') }}
@@ -47,4 +70,4 @@ jobs:
             - name: Run tests
               run: npm run test:jest
             - name: Run Playwright tests
-              run: npx playwright install --with-deps && npm run test:playwright:headless
+              run: npx playwright install --with-deps && npm run test:e2e:headless

.github/workflows/code-qa-markdown.yaml

@@ -0,0 +1,44 @@
+name: Code Quality Assurance - Markdown
+
+on:
+    push:
+        branches: [master]
+        paths:
+            - "**/*.md"
+            - ".markdownlint.json"
+            - ".markdownlintignore"
+            - ".github/workflows/code-qa-markdown.yaml"
+            - "package*.json"
+    pull_request:
+        branches: [master]
+        paths:
+            - "**/*.md"
+            - ".markdownlint.json"
+            - ".markdownlintignore"
+            - ".github/workflows/code-qa-markdown.yaml"
+            - "package*.json"
+
+permissions:
+    contents: read
+jobs:
+    lint-markdown:
+        runs-on: ubuntu-latest
+
+        steps:
+            - name: Checkout repository
+              uses: actions/checkout@v6
+            - name: Use Node.js ${{ matrix.node-version }}
+              uses: actions/setup-node@v6
+              with:
+                  node-version: ${{ matrix.node-version }}
+            - name: Cache Node.js modules
+              uses: actions/cache@v5
+              with:
+                  path: ~/.npm
+                  key: ${{ runner.os }}-node-${{ hashFiles('**/package-lock.json') }}
+                  restore-keys: |
+                      ${{ runner.os }}-node-
+            - name: Run installs
+              run: npm ci
+            - name: Run markdownlint on Markdown files
+              run: npm run lint:markdown

.github/workflows/codeql-analysis.yaml

@@ -50,7 +50,7 @@ jobs:
 
         steps:
             - name: Checkout repository
-              uses: actions/checkout@v5
+              uses: actions/checkout@v6
 
             # Initializes the CodeQL tools for scanning.
             - name: Initialize CodeQL

.markdownlint.json

@@ -0,0 +1,6 @@
+{
+	"MD007": false,
+	"MD010": false,
+	"MD013": false,
+	"MD060": false
+}

.markdownlintignore

@@ -0,0 +1,56 @@
+# Markdown to ignore
+LICENSE.md
+
+# dependencies
+**/node_modules
+/.pnp
+.pnp.js
+
+# VS code
+.vscode/settings.json
+.vscode/launch.json
+
+# System Files
+.DS_Store
+
+# Coverage and testing
+.coverage
+/coverage
+coverage.html
+coverage.out
+coverage.xml
+cypress/screenshots
+cypress/videos
+
+# Playwright
+node_modules/
+test-results/
+playwright-report/
+blob-report/
+playwright/.cache/
+playwright/.auth/
+playwright-report/
+blob-report/
+test-results/
+
+# Packages
+core/scripts/APIandLibraries/**/*
+
+# workbox
+workbox-config.cjs
+core/scripts/serviceWorker
+
+# Visual Studio Code
+.vscode/settings.json
+.vscode/launch.json
+
+# Data files
+.fasta
+.xlsx
+.csv
+
+# PDFs
+.pdf
+
+# Ignore minified files
+*.min.*

.prettierignore

@@ -3,31 +3,35 @@
 /.pnp
 .pnp.js
 
-# Build files
-*.min.js
-*.min.css
-sw.js
-*.js.map
-
-# Packages
-core/scripts/APIandLibraries/**/*
+# VS code
+.vscode/settings.json
+.vscode/launch.json
 
-# R data files
-.Rproj.user
-.Rhistory
-.RData
-.Ruserdata
+# System Files
+.DS_Store
 
-# Server files
-.htaccess
+# Coverage and testing
+.coverage
+/coverage
+coverage.html
+coverage.out
+coverage.xml
+cypress/screenshots
+cypress/videos
+
+# Playwright
+node_modules/
+test-results/
+playwright-report/
+blob-report/
+playwright/.cache/
+playwright/.auth/
+playwright-report/
+blob-report/
+test-results/
 
-# misc
-.DS_Store
-.env.local
-.env.development.local
-.env.test.local
-.env.production.local
-.vscode
+# Packages
+core/scripts/APIandLibraries/**/*
 
 # workbox
 workbox-config.cjs

CHANGELOG.md

@@ -182,7 +182,7 @@ Bug fix:
 
 ## [1.0.0] - 2018-09-20
 
-The official release of SciGrade is here! You can visit it and see all of it in action at https://scigrade.com/ or learn how it works by looking through our EDIT.MD code.
+The official release of SciGrade is here! You can visit it and see all of it in action at <https://scigrade.com/> or learn how it works by looking through our EDIT.MD code.
 
 Enjoy learning with CRISPR on SciGrade!
 -Alex

core/scripts/crispr_scripts.js

@@ -308,28 +308,28 @@ function checkAnswers() {
 					MARgRNAseq = false;
 					MARgRNAseq_degree = 0;
 				} else if (
-					(correctNucleotidePosition >= possible_comparable_answers[i].Position - 1 + 1 &&
-						correctNucleotidePosition <= possible_comparable_answers[i].Position - 1 + 10) ||
-					(correctNucleotidePosition <= possible_comparable_answers[i].Position - 1 - 1 &&
-						correctNucleotidePosition >= possible_comparable_answers[i].Position - 1 - 10)
+					(correctNucleotidePosition >= possibleAnswer.Position - 1 + 1 &&
+						correctNucleotidePosition <= possibleAnswer.Position - 1 + 10) ||
+					(correctNucleotidePosition <= possibleAnswer.Position - 1 - 1 &&
+						correctNucleotidePosition >= possibleAnswer.Position - 1 - 10)
 				) {
 					MARgRNAseq = true;
 					MARgRNAseq_degree = 1;
 					true_counts += 1;
 				} else if (
-					(correctNucleotidePosition >= possible_comparable_answers[i].Position - 1 &&
-						correctNucleotidePosition <= possible_comparable_answers[i].Position - 1 + 20) ||
-					(correctNucleotidePosition <= possible_comparable_answers[i].Position - 1 &&
-						correctNucleotidePosition >= possible_comparable_answers[i].Position - 1 - 20)
+					(correctNucleotidePosition >= possibleAnswer.Position - 1 &&
+						correctNucleotidePosition <= possibleAnswer.Position - 1 + 20) ||
+					(correctNucleotidePosition <= possibleAnswer.Position - 1 &&
+						correctNucleotidePosition >= possibleAnswer.Position - 1 - 20)
 				) {
 					MARgRNAseq = true;
 					MARgRNAseq_degree = 2;
 					true_counts += 1;
 				} else if (
-					(correctNucleotidePosition >= possible_comparable_answers[i].Position - 1 &&
-						correctNucleotidePosition <= possible_comparable_answers[i].Position - 1 + 30) ||
-					(correctNucleotidePosition <= possible_comparable_answers[i].Position - 1 &&
-						correctNucleotidePosition >= possible_comparable_answers[i].Position - 1 - 30)
+					(correctNucleotidePosition >= possibleAnswer.Position - 1 &&
+						correctNucleotidePosition <= possibleAnswer.Position - 1 + 30) ||
+					(correctNucleotidePosition <= possibleAnswer.Position - 1 &&
+						correctNucleotidePosition >= possibleAnswer.Position - 1 - 30)
 				) {
 					MARgRNAseq = true;
 					MARgRNAseq_degree = 3;
@@ -338,7 +338,7 @@ function checkAnswers() {
 
 				// If the sequence if correct, check all other results:
 				if (MARgRNAseq) {
-					const temp_answer = element;
+					const temp_answer = possibleAnswer;
 					// Check if the cut position matches the answer's input
 					if (
 						temp_answer.Position &&

core/scripts/crispr_scripts.test.js

@@ -103,6 +103,11 @@ describe("crispr_scripts.js - Utility Functions", () => {
 		const cases = [
 			{ name: "short sequence ATCG", input: "ATCG", want: "CGAT" },
 			{ name: "longer sequence", input: "GCTCGTGACCACCCTGACCT", want: "AGGTCAGGGTGGTCACGAGC" },
+			{
+				name: "gRNA sequence from eBFP marking tests",
+				input: "AAGCACTGCACGCCGTGGGT",
+				want: "ACCCACGGCGTGCAGTGCTT",
+			},
 			{ name: "empty sequence", input: "", want: "" },
 			{ name: "single nucleotide A", input: "A", want: "T" },
 			{ name: "single nucleotide T", input: "T", want: "A" },

core/scripts/runtime.test.js

@@ -113,25 +113,6 @@ describe("runtime.js - Runtime Flow Helpers", () => {
 	});
 
 	describe("redirectCRISPR()", () => {
-		const cases = [
-			{
-				name: "clears and repopulates main container",
-			},
-			{
-				name: "calls loadCRISPRJSON_Files before fillGeneList",
-			},
-		];
-
-		it.each(cases)("$name", async ({ name }) => {
-			// Execute the ACTUAL imported function
-			await redirectCRISPR();
-
-			// Verify
-			expect(mockJQuery.empty).toHaveBeenCalled();
-			expect(global.loadCRISPRJSON_Files).toHaveBeenCalledTimes(1);
-			expect(global.fillGeneList).toHaveBeenCalledTimes(1);
-		});
-
 		it("ensures DOM elements are properly cleared before population", async () => {
 			// Execute the ACTUAL imported function
 			await redirectCRISPR();
@@ -177,23 +158,4 @@ describe("runtime.js - Runtime Flow Helpers", () => {
 			expect(executionSequence).toEqual(["empty", "append", "loadCRISPRJSON_Files", "fillGeneList"]);
 		});
 	});
-
-	describe("Integration: Runtime flow initialization", () => {
-		it("properly initializes runtime flow when both functions are called", async () => {
-			mockElement.value = "APOE";
-			global.checkAnswers_executed = true;
-			global.document.getElementById.mockReturnValue(mockElement);
-
-			// Execute ACTUAL imported functions
-			await redirectCRISPR();
-			loadGeneContent();
-
-			// Verify complete state
-			expect(global.possible_gene).toBe("APOE");
-			expect(global.checkAnswers_executed).toBe(false);
-			expect(mockJQuery.empty).toHaveBeenCalled();
-			expect(global.loadCRISPRJSON_Files).toHaveBeenCalled();
-			expect(global.fillGeneList).toHaveBeenCalled();
-		});
-	});
 });