Skip to content

Repository files navigation

Scripts and Oneliners explained

Aimer G. Diaz

Welcome to my code repository, most or all of it I’ve learned in a very inclusive sense of the word (including copy from internet forums), following this beautiful logic of public domain I’ve made these notes available, the idea it’s to have a server-independent repository, a repository on the cloud, or should I say, on the bottom of the ocean with several copies in several sites of the world, for today and maybe, just maybe, even available on a post-global ecological disaster era, available physically but not online.

I will try to indicate here the structure of all the folders of this repository, each folder anyway will have more information with its own R markdown. The idea of this out of site file is to indicate meta-folders features, like links for indicate where the same code is used in the exactly same way, or when I made a change for any reason for a specific project (all of them would be on bioinformatics next-generation data analysis, my main expertise).

As an example a very basic but useful code I wrote in bash syntax and I use it for every project, it’s a code I call sra_download.sh, which take a given list (or even better with the SRA Run selector table from Sequence Read Archive (SRA)) and download differentiating, if the input table indicate, if the fastq file is single or paired end. Let’s explore the latest data set I was working when I wrote this document, from the SRA site:

SRA_Code Sequence_Tech Cell_location_stage Strain Total_Sequences Length Source ServerName
SRR8859642 PAIR END Procyclic EATRO 1125 85,827,714 125/125 Cooper2019_gRNA Cooper2019_gRNA_E1125PC
SRR8859640 PAIR END Bloodstream EATRO 1125 79,132,567 125/125 Cooper2019_gRNA Cooper2019_gRNA_E1125BS
SRR8859641 PAIR END Bloodstream + Procyclic MIX EATRO 1125 148935513 125/125 Cooper2019_gRNA Cooper2019_gRNA_E1125Mix

The first version of the file is on the master thesis codes folder, however this version did not has the option to download the SRA considering if it’s single or paired end. The latest version of it does and it’s on the Trypanosoma repository.


Codes repository

In order to start, I will comment here sections of the codes and the way I apply them to solve specific problems, in other terms, here what you will find is a selection of commented and finished codes in bash, awk, perl, python, R and Latex languages, plus R markdowns files explaining these codes using small toy data sets. Finally in this document you can also find useful one liners commented, also with toy examples.

Let’s start with the one-liners, it’s true they are not the best solution, however they are fast, they avoid us to write or re-adapt whole blocks of code to particular solutions, they are modular and somehow, they are like culture, beyond if it’s recommended or not to use them, some people love them and I am one of those. I will introduce them first, because I always started with them to explore the original data, already made analysis, new formats, supplementary material, etc.

Awk

Awk codes are my favorite, the one liners are extreamlly useful, fast, weird but incredible, but they can be adapted as bash codes and even using in parallel computing by the amazing GNU parallel software with minor modifications as I will show here. But let’s start, the selected awk codes and toy data samples will be here.

Generalities of my awk codes

All the languague I’ve mentioned before will have the same structure for this section: main applications of the main control structures (, and ), combinations of control structures and most employed codes so far. Before enter to control structres, there are awk specific features important to highlight:

Printing header line -Begin command-:

Generating a header row, while modifying the content that follows, for instance, by substituting an element of a field:

awk -v OFS="\t" -F'\t'  'NR==1 {print "ID","NGenes","Genes"} {split($2,a," "); gsub(" ",",", $2);print $1,length(a),$2}'  

In case there is already a header line, a new one can be generated as follow:

awk -F','  -v n=1 -v OFS="\t" 'NR==1 {print "#chrom","pos","rsid","ref","alt","neg_log_pvalue","maf","score","alt_allele_freq" } NR>2{print "Chr"$1,$2,"rs"n,"A","T","0.01",$3,$4,"."} ' GWAS_CaMV.csv 

The newly generated line count as a 1, then to ignore the previous header we would need NR>2

Reducing multiples lines into a single line to analyse -getline command-:

Awk can work not only line per line, it’s able to integrate as a unit of analysis files which format might have a specific set of lines per element, for instance 2 lines describe a single sequence in a fasta format or 4 lines a fastq file, how to integrate those lines to a single unit of analysis?. The getline awk function it’s a faster way to make it, meaning very simple and useful one-liners of awk might be used for files like this.

First example a Fastq to Fasta file converter using the next one-liner:

awk ' BEGIN {OFS = "\n"} {header = $0 ; getline seq ; getline qheader ; getline qseq ; print ">"header,seq}' $1 > $name.fa

A very similar task can be achieved with a derivative code, like change the headers of multi-fasta file for a shorter version of it or simply to add the sequence length for blast output filters, which can be achieved using:

awk  ' BEGIN {OFS = "\n"} {header = $0 ; getline seq  ; gsub(/;Ant.*/,"",header); header=header";length="length(seq);  print header,seq}' $1 > $name.fa

This code is integrated to a function of change suffix on the code called fq2fa.sh. The function getline must be call as many line we want to integrated in a single unity of analysis.

Focus on user defined lines NR% command

Individual read length and total quantity of nucleotides

echo -ne "@seq1\nACGAGGAGGACGTACGTAGCTAGCGAGCGATCTATCGATGCTAC\n+\nACGAGGAGGACGTACGTAGCTAGCGAGCGATCTATCGATGCTAC\n@seq2\nACGAGCGAGCATCGAGCTAGCTGACTAGCTTAGCTATCG\n+\nnCGAGCGAGCATCGAGCTAGCTGACTAGCTTAGCTATCG\n"  > file.fastq
awk '{ if(NR%4==2){print length($0);} }'  file.fastq  

awk 'BEGIN{sum=0;}{if(NR%4==2){sum+=length($0);}}END{print sum;}'  file.fastq 

Change delimiters, regrex in awk 101:

A related issue to the previous one it’s the case when you want to change the field delimiter of certain lines, but not all, a typical example in bioinformatics of this task it’s transform a multi-fasta file with multiple jump lines into a single oneline sequence per feature, graphically:

From

>1
ACCCAGAGAGTGAG
ACCAACACACAGTT`

To

>1
ACCCAGAGAGTGAGACCAACACACAGTT`

To make it we can use the regrex expression integrated with the simplified if control loop of awk:

awk '/^>/{printf("\n%s\n",$0);next; } { printf("%s",$0);}  END {printf("\n");}' $1 | grep -v "^$" > $1.ol.fa 

On this awk-oneliner, we first select those lines who do start with > /^>/ anything in between would be separated only by one jump of line per each ^> line found. This code it’s called oneliner.awk

Read files separated by comma, -F and gsub commnad

There is not better fast and time-saving file separator as awk’s -F commnad, let’s start with a common issue analyzing common bioinformatics files as CSV files, haven’t you face that annoying CSV files with text in the same field where is also commas there?, usually this :

NCBI gen omnibus dataset has such problem and awk has the solution:

awk -F',' 'OFS="\t"{gsub("\"","",$0);gsub(" |, ","_",$0);print $1,$2,$4,$8}' $1 
cat AWK/sentence.temp 
cat AWK/separator.awk
#Run in terminal 
# dos2unix AWK/separator.awk
bash AWK/separator.awk AWK/sentence.temp "gsub"
## "PRJNA272807","In plants, decapping prevents RDR6-dependent production of small interfering RNAs from endogenous mRNAs",3702,"Arabidopsis thaliana","Eukaryota; Plants; Land Plants",,"Primary submission","Transcriptome or Gene expression","Yes","Yes","2015-01-16"
## if [ "$2" == "gsub" ]
## then
## 
## echo -ne "\nExtracting only the fields 1,2,4 and 8 \n\n"
## 
## awk -F',' 'OFS="\t"{gsub("\"","",$0);gsub(" |, ","_",$0);print $1,$2,$4,$8}' $1 
## elif [ "$2" == "F" ]
## then 
## 
## awk -F'(,"|",)' 'OFS="\t"{gsub(" ","_",$0); print $1,$2,$4,$8}' $1 | tr -d '"'
## 
## elif [ "$2" == "SRA" ]
## then
## 
## echo -ne "\nExtracting most informative fields \n\n"
## 
## awk -F'(,"|",)' -v OFS="," '{ print $1,$5 }' $1  | awk -F',' -v OFS="," '{gsub(" ","_",$0);gsub("ncRNA-Seq","smallRNA-Seq",$2); print $1,$16,$2,$19,$11,$24,$20,$10,$13,$3,$4,$26}'
## 
## elif [ "$2" == "IF" ]
## then
## 
## awk -F'(,"|",)' -v OFS=","  '{gsub(" ","_",$0); print $1,$5 }' $1  | awk -F',' -v OFS="," '{if (NR == "1") {$10=$11=$12=""; print $1,$19,$2,$22,$14,$27,$23,$13,$16,$3,$4,$29 } else {gsub("ncRNA-Seq","smallRNA-Seq",$2);print  $1,$16,$2,$19,$11,$24,$20,$10,$13,$3,$4,$26}}'
## 
## fi
## Extracting only the fields 1,2,4 and 8 
## 
## PRJNA272807  In_plants_decapping_prevents_RDR6-dependent_production_of_small_interfering_RNAs_from_endogenous_mRNAs  Arabidopsis_thaliana    Transcriptome_or_Gene_expression

Another great solution is by using awk -F command, which allow us to split fields using regrex expression, in this case :

awk -F'(,"|",)' 'OFS="\t"{gsub(" ","_",$0); print $1,$2,$4,$8}' $1

A more complicated case comes from SraRunTable.txt formatting, which might have at the same time, comma separated fields, but not " demarcation, a annoying solution is to homogenize the header and the fields with such characteristic, as here the original file now includes " in the header, to be able to run with the same syntax

head -n 1 AWK/SraRunTable_edited.txt 

bash AWK/separator.awk AWK/SraRunTable_edited.txt "SRA"
## Run,Assay Type,AvgSpotLen,Bases,BioProject,BioSample,Bytes,Center Name,Consent,"DATASTORE filetype","DATASTORE provider","DATASTORE region",days_past_infection,ecotype_background,Experiment,Genotype,Instrument,Library Name,LibraryLayout,LibrarySelection,LibrarySource,Organism,Plant_age,Platform,ReleaseDate,Sample Name,source_name,SRA Study,treatment
## 
## Extracting most informative fields 
## 
## Run,LibraryLayout,Assay_Type,Organism,ecotype_background,source_name,Plant_age,days_past_infection,Genotype,AvgSpotLen,Bases,treatment
## SRR17697100,PAIRED,smallRNA-Seq,Arabidopsis_thaliana,Col-0,rosette,39_days,21,dcp5-1/rdr6-15,102,4009784628,CaMV_(CM184I)_infected

For this situation a double separation using both previous criteria:

Text reformatting or search and save function //

The previous detailed command getline, applied on structured format might help to reformat complex files in simpler single lines formats. However if the text have not a regular and constant number of lines per object, this approach is not longer suitable. As alternative, awk has a saving command for regrex search, who might use conserved features of each entry as an organizer anchor, an example of it, it’s the messy file of tasiRNAs from Small RNAs Carrington :

grep  -n -B 1 -A 20  atTAS3a  AWK/tasiRNA_generating_loci.txt
## 185-TAS ID:      10
## 186:Discription: atTAS3a(At3g17185)
## 187-Coordinate:  Chr3:5861491..5862437
## 188-Transcript:  atcccaccgtttcttaagactctctctctttctgttttctatttctctctctctcaaatg
## 189-                 aaagagagagaagagctcccatggatgaaattagcgagaccgaagtttctccaaggtgat
## 190-                 atgtctatctgtatatgtgatacgaagagttagggttttgtcatttcgaagtcaattttt
## 191-                 gtttgtttgtcaataatgatatctgaatgatgaagaacacgtaactaagatatgttactg
## 192-                 aactatataatacatatgtgtgtttttctgtatctatttctatatatatgtagatgtagt
## 193-                 gtaagtctgttatatagacattattcatgtgtacatgcattataccaacataaatttgta
## 194-                 tcaatactacttttgatttacgatgatggatgttcttagatatcttcatacgtttgtttc
## 195-                 cacatgtatttacaactacatatatatttggaatcacatatatacttgattattatagtt
## 196-                 gtaaagagtaacaagttcttttttcaggcattaaggaaaacataacctccgtgatgcata
## 197-                 gagattattggatccgctgtgctgagacattgagtttttcttcggcattccagtttcaat
## 198-                 gataaagcggtgttatcctatctgagcttttagtcggattttttcttttcaattattgtg
## 199-                 ttttatctagatgatgcatttcattattctctttt[tcttgaccttgtaaggccttttct
## 200-                 tgaccttgtaagaccccatctctttctaaacgttttattattttctcgttttacagattc
## 201-                 tattctatctcttctcaatatagaatagatatctatctctacctctaattcgttcgagtc
## 202-                 attttctcctaccttgtctatccc]tcctgagctaatctccacatatatcttttgtttgt
## 203-                 tattgatgtatggttgacataaattcaataaagaagttgacgtttttct
## 204-TAS region:  696..863
## 205-m/siR TAR1:  CTTGTCTATCCCTCCTGAGCTA
## 206-m/siR TAR2:  ggtgttatcctatctgagctt
## --
## 3525-TAS ID:         68
## 3526:Discription:    atTAS3a(At3g17185)
## 3527-Coordinate:     Chr3:5861491..5862437
## 3528-Transcript:     atcccaccgtttcttaagactctctctctttctgttttctatttctctctctctcaaatg
## 3529-                aaagagagagaagagctcccatggatgaaattagcgagaccgaagtttctccaaggtgat
## 3530-                atgtctatctgtatatgtgatacgaagagttagggttttgtcatttcgaagtcaattttt
## 3531-                gtttgtttgtcaataatgatatctgaatgatgaagaacacgtaactaagatatgttactg
## 3532-                aactatataatacatatgtgtgtttttctgtatctatttctatatatatgtagatgtagt
## 3533-                gtaagtctgttatatagacattattcatgtgtacatgcattataccaacataaatttgta
## 3534-                tcaatactacttttgatttacgatgatggatgttcttagatatcttcatacgtttgtttc
## 3535-                cacatgtatttacaactacatatatatttggaatcacatatatacttgattattatagtt
## 3536-                gtaaagagtaacaagttcttttttcaggcattaaggaaaacataacctccgtgatgcata
## 3537-                gagattattggatccgctgtgctgagacattgagtttttcttcggcattccagtttcaat
## 3538-                gataaagcggtgttatcctatctgagcttttagtcggattttttcttttcaattattgtg
## 3539-                ttttatctagatgatgcatttcattattctctttttcttgacc[ttgtaaggccttttct
## 3540-                tgaccttgtaagaccccatctctttctaaacgttttattattttctcgttttacagattc
## 3541-                tattctatctcttctcaatatagaatagatatctatctctacctctaatt]cgttcgagt
## 3542-                cattttctcctaccttgtctatccctcctgagctaatctccacatatatcttttgtttgt
## 3543-                tattgatgtatggttgacataaattcaataaagaagttgacgtttttct
## 3544-TAS region:     704..829
## 3545-m/siR TAR:      tacctctaattcgttcgagtc
## 3546-TAR Method:     Degradome analysis

As the sequence length change depending on each loci, an approach to extract each row of interest using awk is:

awk '/^Discription:/{d=$2};/^Coordinate/{c=$2};/^TAS region:/{s=$3}/^TAR/ {print d,c,s}'  AWK/tasiRNA_generating_loci.txt | grep atTAS3a
bash AWK/reformatting.sh  AWK/tasiRNA_generating_loci.txt | grep atTAS3a
## awk: cmd. line:1: warning: escape sequence `\.' treated as plain `.'
##          atTAS3a(At3g17185)          Chr3:5861491..5862437
##          atTAS3a(At3g17185)          Chr3:5861491..5862437

Substrings

awk ' BEGIN {OFS = "\n"} {header = $0 ; getline seq ; if (seq ~ /Y[A-Z]$/){ taa=substr(seq,length(seq)-1,length(seq)) ;  print header"\n"taa}}'  multi.fa > 2aa.fa

If loops

Conditional evaluation

Using the same previous example, this time without modifiend the header of the SRA original file, but using if structure to indicate differential processing of first line vs the complementary text:

awk -F',' -v OFS="," '{if (NR == "1") {$10=$11=$12=""; print  } else {gsub("ncRNA-Seq","smallRNA-Seq",$2);print  }}'
bash AWK/separator.awk AWK/SraRunTable.txt "IF"
## Run,LibraryLayout,Assay_Type,Organism,ecotype_background,source_name,Plant_age,days_past_infection,Genotype,AvgSpotLen,Bases,treatment
## SRR17697100,PAIRED,smallRNA-Seq,Arabidopsis_thaliana,Col-0,rosette,39_days,21,dcp5-1/rdr6-15,102,4009784628,CaMV_(CM184I)_infected

This code has an additional unneeded feature, the deletion of three fields, but it works to illustrate differential processing depending of an If condition.

IF in arrays as a classificator:

One of my favorite codes made a classificatory tasks extremely fast and with just a handful set of commands, sadly the economy of the codes makes it a little dark, especially for AWK beginners.

Let’s see a toy example:
#We can create a toy data (td) set  with a chromosome location of a given gene

#Chromosome  #Duplicated Gene
#chr1       geneA
#chr2       geneB
#chr3       geneA

echo -ne "Chromosome\tDuplicated Gene\nchr1\tgeneA\nchr2\tgeneB\nchr3\tgeneA\n" > AWK/td_Gene_duplication_per.txt 

Sadly, although it seems awk engine is implemented for R markdown, it requires an additional effort to make it work, here the code of how to run awk using knitr, and here the R markdown output of that code, however after several attempts I could not make awk work here, anyway, awk is integrated as a command on bash, then we can write the comand of awk as a awk script and executing with bash.

The code is
head -n 25 AWK/classificator.awk 
## #!/bin/bash
## # Welcome my github readers, this an awk script commented, in reality this code can
## # be excecuted as a one liner, even including saving the process on a new file, but R markdown 
## # does not handle all of the awk power, by now
## #
## # The  One-liner format
## #
## # awk 'NR>1{if(a[$2])a[$2]=a[$2]" and "$1; else a[$2]=$1;}END{for (i in a) print "The gene "i", is located on chromosome "a[i];}' 
## #
## # But I will explained as a script here
## #     awk 'NR>1{
##  # Omit the first line   
## #     if(a[$2]) a[$2]=a[$2]" and "$1
##  # make an array with the second field (column by default splitted by tab)
##  # and if the element is already on the array, add extra attributes (first column) as a coment separated with ` and `
## #     else a[$2]=$1} END  {for (i in a)
## # if the element is not on the array, save it as a new element with its related attribute
## #     print "The gene "i", is located on chromosome "a[i] }' $1
##   # Finally a for loop for print array elements with a presenting words
##   # Without commetns clean like this: 
## awk 'NR>1{ if(a[$2]) a[$2]=a[$2]" and "$1; else a[$2]=$1} END  {for (i in a)  print "The gene "i", is located on chromosome "a[i]}' $1
The output of this script
bash AWK/classificator.awk AWK/td_Gene_duplication_per.txt
## The gene geneA, is located on chromosome chr1 and chr3
## The gene geneB, is located on chromosome chr2
What happen if we include more genes ?
echo -ne "chr4\tgeneA\n" >> AWK/td_Gene_duplication_per.txt 

bash AWK/classificator.awk AWK/td_Gene_duplication_per.txt
## The gene geneA, is located on chromosome chr1 and chr3 and chr4
## The gene geneB, is located on chromosome chr2

Now let’s see this code applied to real world problems, at least how I used, one example is here PRINT here how it work to make quick table (Mirnomics project) or for multi-fasta file duplication cleaning (gRNAs_total.fa)

DEVELOP HERE


IF and arrays as de-duplicated control structures:

Sum a particular column

echo -ne "reads\n12\n123\n213\n12\n" > AWK/extra_column.txt 
paste AWK/td_Gene_duplication_per.txt  AWK/extra_column.txt   > AWK/td_Gene_duplication_values.txt
rm AWK/extra_column.txt 
head AWK/td_Gene_duplication_values.txt
awk '{sum+=$3} END {print sum}'  AWK/td_Gene_duplication_values.txt
## Chromosome   Duplicated Gene reads
## chr1 geneA   12
## chr2 geneB   123
## chr3 geneA   213
## chr4 geneA   12
## 360

Sum entries belonging to the same factor

echo -ne "chr1\tgeneA\t15\n" >> AWK/td_Gene_duplication_values.txt
sort -k 1 AWK/td_Gene_duplication_values.txt 
echo -ne "\n\n"
awk 'NR>1{sum[$1"\t"$2]+=$3} END {for (gene in sum) print gene, sum[gene]  }'  AWK/td_Gene_duplication_values.txt | sort -k 1 
## chr1 geneA   12
## chr1 geneA   15
## chr2 geneB   123
## chr3 geneA   213
## chr4 geneA   12
## Chromosome   Duplicated Gene reads
## 
## 
## chr1 geneA 27
## chr2 geneB 123
## chr3 geneA 213
## chr4 geneA 12

Sum only non duplicated entries

 awk 'NR>1 && !sum[$2]++'  AWK/td_Gene_duplication_values.txt | awk 'NR>1{sum[$1"\t"$2]+=$3} END {for (gene in sum) print gene, sum[gene]  }'
## chr2 geneB 123

For and While

Sum all columns

awk 'BEGIN{FS=OFS=","}
     NR==1{print}
     NR>1{for (i=1;i<=NF;i++) a[i]+=$i}
     END{for (i=1;i<=NF;i++) printf a[i] OFS; printf "\n"}' file

Change the file format

A useful way to change the file format, and at the same time printing recursively all columns of a file, the next code takes a file comma separated, filtered by padj value field and them print the selected rows in a tab separated file

awk -F',' -v OFS="\t"  '$8 < 0.05 {out=$1; for (i=2;i<=NF;i++) out= out "\t" $i; print out}'

From blast out to Bed file

Awk is a powerful text processor and there is not a very frequent task in bioinformatics than blast results cleaning. It’s important to know the field you want to use for text parsing, a practical way to get this information is:

head -n 1 <FILE> | tr '\t' '\n' | awk '{print NR"\t"$0}'

I usually work with a modified version of the output format 6, declaring all the name of the fields I’m interested and including nident or number of identical matches:

blastn  -query <QUERY> -db <SUBJECT> -outfmt   "6 qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue bitscore qlen slen nident" -perc_identity 10 -task blastn -word_size 10 -out 

If there is not interest in filtering the blast result, reusing it as an annotation file, the next command would be quite useful

awk -v i=1 'OFS="\t"{if ($9 < $10) {sense="+"; S=$9} else {sense="-";S=$10}; if ($9 < $10) E=$10; else E=$9; print $2,S,E,"viral2TAIR_hit_"i,sense, E-S , $1, "id:"$3";aln:"$4";nind:"$15 ; i++ }' collection2TAIR.out | sort -k1,1 -k2,2n  > collection2TAIR.bed
## awk: fatal: cannot open file `collection2TAIR.out' for reading: No such file or directory

  • While, being honest I have never used while loop on awk. But I do use while structure on bash followed by an awk code, which is, awk as line per line variable mining tool, which employ the next code structure:
echo  "This a toy example; with a semicolon separator structure; and I want to show you; hidden variable X 
that using bash while loop; and awk -F separator command; I can extract pf each line the; hidden variable Y" > toy_structure.txt

head toy_structure.txt
## This a toy example; with a semicolon separator structure; and I want to show you; hidden variable X 
## that using bash while loop; and awk -F separator command; I can extract pf each line the; hidden variable Y
counter=1   ### Bash counter - reference here for access from other sites
while read line 
do 
variable=`echo $line | awk -F'; hidden variable' '{print $2}'`
echo this is the value of the hidden variable: "$variable" on the line: "$counter" 
let counter=counter+1 
done < toy_structure.txt 

rm -f toy_structure.txt
## this is the value of the hidden variable:  X on the line: 1
## this is the value of the hidden variable:  Y on the line: 2

A real world problem where I use awk inside a bash while loop structure is in a fastqc quality information miner script, extracted from NGS_statistics.sh script:

Non excecutable script
 while read library
 do
 FILE="$1"/Fastq/Quality/$library/fastqc_data.txt
 
 type_file=`echo $library | egrep -o  "_fastqc|_reduced_cor_fastqc|.reduced_fastqc|_trim_fastqc"`
 
 name=`echo $library | awk -v sus="$type_file"  '{gsub(sus,"",$0);print $0}'`

 if [ "$type_file" == "_fastqc" ]
 then
 lib_type="raw"
 elif [ "$type_file" == "_reduced_cor_fastqc" ]
 then
 lib_type="ms_reduced"
 elif [ "$type_file" == ".reduced_fastqc" ]
 then
 lib_type="reduced"
 elif [ "$type_file" == "_trim_fastqc" ]
 then
 lib_type="tmm_reduced"
 fi

 awk '/^Total Sequences/{ts=$3}  /^Sequence length/{print "'$name'" "\t" "'$lib_type'" "\t" $3 "\t" ts}' $FILE   >> $1"Results/Statistics/Total_size.txt"

 done < dir_list.txt

  • For loops on awk are mainly array handlers:

DEVELOP HERE


Bash

Here as well as with awk there are many commands that using cleverly you can get results with a single one-liner, or post process, clean, adjust ins/outs quickly or to change formats to give to more complicated programs. Bash it’s for me, as you saw previously, the main executor, for other people it could be shell, or even anything without command line, by running all in environments like this, but with VIM + Bash + awk + perl virtually you could do everything on structured programming. But before to get into the details of how I used recurrent blocks of code, I will introduce a unique aspect of bash:

Generalities of my bash codes

Bash as well as AWK is quite flexible, however most of the time I do use the three control structures for, while and if, then, else for data organization, classification or text processing and quality control. But before to enter to each control structure let’s talk some other features of Bash beyond the control statements itself.

Sort command for bionformatics format

Sort unix command is viable and quite frequent way to organize annotation files, bed or gff formats:

  1. For bed files :
sort -k1,1 -k2,2n
  1. For gff files
(grep ^"#" <gff file> ; grep -v ^"#" <gff file> | grep -v "^$" | grep "\t" | sort -k1,1 -k4,4n)

Piping on bash: beyond “|”

Bash is awesome specially when we talk about pipes, input and output immediately re-direction. However for beginners the main command for piping is usually “|”, which limits piping to comands who tolerate input redirection in such way, however there are software which cannot be piped with “|” but it might accept “-” for input file declaration, specially those who requires a -i parameter to indicate the input file, then the piping way for such programs is ” | software -i - ” .

DEVELOP HERE - example of - for piping

A less usual piping commands is the combined operator “<( code here )”, which could be interpreted as “take the output of the command between parenthesis as an input”. This structure could be used to expand the capabilities to of grep command but in the option of grepping a list of terms (grep -f). Using the -f parameter on a grep search we cannot add the single pattern options available also as parameter, for instance, searching the list of pattern at the beginning of each line: grep -f "^", however using <() this task it’s possible. Let’s explore using a real world problem.

In a file of small RNAs who target genes for mRNA edition process (U deletion or insertion), each line represent a guide RNA, whoever some of them has complex gene target assignation, meaning for instance like:

“Unknown_RPS12”

Where the first category means the guideRNA have gotten a gene target after a secondary process, but a gene without a gene target even after applying the secondary process, could still lack of a gene assignation. Additional patterns like RPS12_Unknown_RPS12, make even harder the use of auxiliary awk syntax. Therefore, to quantify the exact amount of gRNAs with pure Unknown gene targets we can use the <() syntax as follow:

First generate the pattern to search using the single line grep regular expressions as “^” or “$” or others, for instance starting with a file like this:

head -n 1 BASH/grep_lists_example.txt
## 2481_319857-5

Where each line represent a single ID, now as this pattern in the file we want to search it might be place on more than one column, a exact grep (-w) search would not be enough, the file to search looks like:

head -n 1 BASH/file2search.txt
## 2481,319857-5:3775637-1:612463-2:1522040-1:1644068-1:728577-2:1155110-1:2471552-1:3702130-1:2610329-1:2598439-1:3570331-1:1741739-1:3268900-1:3271495-1:1374495-1:1145964-1,94,94,AAATATAACATATCTTATATCTGAATCTAACTTGTAATATGTGAATTTTTTTTTTTTTTTT,AAATATAACATATCTTATATCTGAATCTAACTTGTAATATGTGAA,RPS12_A1,1306,68762-

The pattern we are interested is the first field of this comma separated file, as it’s numerical it might happen in many places, then what we need to search is a list of ids who start exactly with that number and ends with a comma, we can create a list of IDs with these features:

bash AWK/printBeginningEnd.awk BASH/grep_lists_example.txt  > BASH/tempids.sh

head -n 1 BASH/tempids.sh
## echo -ne "^2481,\n^68762,\n^28853,\n^54107,\n^68071,\n^68171,\n^115266,\n^24851,\n^37211,\n^102948,\n"

With awk basically we have created a script who writes another script, which tells to bash how to print the code, if we excecute this code it will look as follow:

bash BASH/tempids.sh | head -n 2
## ^2481,
## ^68762,

Now with this script we can run the line bash tempids.sh inside <() command as an input for the command grep -f:

time (bash BASH/piping.sh BASH/file2search.txt)
head BASH/piping.sh
##       7 RPS12_A1
##       3 RPS12_A2
## 
## real 0m0,003s
## user 0m0,002s
## sys  0m0,004s
## grep -f <(bash  BASH/tempids.sh) $1 | awk -F',' '{print $7}'  | sort | uniq -c

In such way this code is equivalent to run grep in a for loop as:

bash BASH/piping_alternative.sh BASH/file2search.txt
head BASH/piping_alternative.sh
##       7 RPS12_A1
##       3 RPS12_A2
## 
## real 0m0,007s
## user 0m0,005s
## sys  0m0,005s
## tempids=()
## tempids=$(cut -d '_' -f 1  BASH/grep_lists_example.txt)
## time ( for f in ${tempids[@]}; do grep "^"$f","  $1; done | cut -d ',' -f 7  | sort | uniq -c )

Even faster than an awk search:

bash BASH/awk_regrex_insideFor.sh BASH/file2search.txt 
tail -n 1  BASH/awk_regrex_insideFor.sh
##       7 RPS12_A1
##       3 RPS12_A2
## 
## real 0m0,012s
## user 0m0,004s
## sys  0m0,010s
## time ( for f in ${tempids[@]};  do  awk -F',' '/^'$f',/{print $7}' $1 ; done | sort | uniq -c  ) # $1 ~ /^'$f'$/ equivalent

However the first code is much faster as time command show us, the reason of this is because the first is in reality a single grep search without control structures.

The second code has the bash array structure and the way it can be feed it, also as an alternative to avoid temporary files. Also includes how we can access or called in a bash for loop, more of bash arrays here.

Folder syncronization with rsync

Specially useful command for servers with file deletion programs, this command will ensure you data security:

rsync -av /mnt/ls15/scratch/users/gutie190/MaxiCircles/ /mnt/home/gutie190/Trypanosomes_RNA_editing/MaxiCircles/NewMaxiCircles/

This command will copy all files from the scratch directory to the safe local directory, where there is not deletion policty, but disk space limitations. Source

-a means The files are transferred in “archive” mode, which ensures that symbolic links, devices, attributes, permissions, ownerships, etc. are preserved in the transfer.

Each time the mother folder is modified, you should run again the command, rsync remote-update protocol will update the file by sending only those different to the already synchronized files.

By default rsync only add files to the destination folder that have been added to the source folder, adding or modifying files that have been changed in the source folder but does NOT delete any files if they have been deleted in the source. To delete files in the target, add the –delete option to your command.

rsync -avh source/ dest/ --delete

Sometimes previous to rsync it’s important to delete empty folders, which may be done with find:

find . -type d -empty -delete

Grep with perl regrex

Grep command is one of the most famous search software known, it’s so powerful thank it’s possible to use together with other languague as perl, for instance, in a complex data set as the following:

head -n 8 BASH/complex_formatting.txt
## 1. The Arabidopsis F-box protein FBW2 degrades AGO1 to avoid spurious loading of illegitimate small RNA [PARE-seq]
## (Submitter supplied) RNA silencing is a conserved mechanism in eukaryotes and is involved in development, heterochromatin maintenance and defense against viruses. In plants, ARGONAUTE1 (AGO1) protein plays a central role in both microRNA (miRNA) and small interfering RNA (siRNA)-directed silencing and its expression is regulated at multiple levels. Here we report that the F-box protein FBW2 targets proteolysis of AGO1 by a CDC48-mediated autophagy mechanism. more...
## Organism:       Arabidopsis thaliana
## Type:           Non-coding RNA profiling by high throughput sequencing; Other
## Platform: GPL17639 18 Samples
## FTP download: GEO (TXT) ftp://ftp.ncbi.nlm.nih.gov/geo/series/GSE169nnn/GSE169433/
## SRA Run Selector: https://www.ncbi.nlm.nih.gov/Traces/study/?acc=PRJNA716605
## Series          Accession: GSE169433    ID: 200169433

For each entry there are 7 lines of information, to extract an specific query, non separated information, with only alphanumeric characters match, including connector characters as “_” or, we can use grep -oP command and perl “\w+” expression to include the whole word, as follow :

grep -oP "Accession: \w+"  BASH/complex_formatting.txt
## Accession: GSE169433
## Accession: GSE169324

The information include in perl matching characters as + can be displayed using:

unichars -a -u '\w' | wc -l 
## bash: line 1: unichars: command not found
## 0

To check the difference in perl matching characters, we can use unichars and diff command, however they are not available in all unix systems

diff -u  <( unichars -a -u '\w' )  <( unichars -a -u '\d' )
## bash: line 1: unichars: command not found
## bash: line 1: unichars: command not found

Use defined match delimiters

A more intuitive, versatile and controllable way for the same task is the perl “?” and “(?=)” regrex pairs, which allow us to define the limits of character exploration. Let’s use an aburd example, such as matching any characters before a defined word (“abc”) is found, without including the define word as an output.

 echo addfadfaabc1234 | grep -oP "(.+?)(?=abc)"
 #One liner perl version of this is
 # perl -ne ' $_ =~ s/(.+?)(?=abc)/$1/; print $1;' 
## addfadfa

Using the previous complex formatting text:

cat BASH/complex_formatting.txt | grep -oP "Type:(.+?)(?=[\n|;])"  
## Type:           Non-coding RNA profiling by high throughput sequencing

An equivalent expression to “\w+” examples

grep -oP "(Accession:.+?)(?=ID)"  BASH/complex_formatting.txt
## Accession: GSE169433    
## Accession: GSE169324

Generate egrep pattern

Using the previous syntax allow us to generate a multiple egrep pattern generator, a commonly use term with several applications as single gene protein isoform quantification, for instance. In a file with Uniprot Ids for each gene with this format (TAIRid2Uniprot.txt):

TAIR Uniprot
AT1G13730 AEE29061.1
AT1G69250 AEE34901.1
AT1G69250 AEE34902.1

The next command would be able to generate the combined non-redundant search term “AEE29061.1|AEE34901.1|AEE34902.1”

for g3bp  in  AT1G13730 AT1G69250 
do
uniprot=`grep -w $g3bp TAIRid2Uniprot.txt | awk '{gsub(" ","",$2);printf $2"|"}' | grep -oP "(.+?)(?=\|)" \|
perl -ne 'chomp $_; print $_ ' `
echo $uniprot 
# Beyond the interest of print the modification, we can also print the sequence associated with both ids 
#  zcat TAIR10.1_protein.ol.fa.gz |  egrep  -A 1 --no-group-separator $uniprot | awk -v tair="$g3bp" ' BEGIN {OFS = "\n"} {header = $0 ; getline seq ; gsub(">",">"tair"_",header) ;  print header,seq}'
done

Find and other bash commands

Find command is one of the most useful tools in unix systems, it’s the google inside this beautiful operative system, not only because it does allow us to find any file or folder using regrex, but also because it’s able to search inside the files, including pdfs files (in case pdfgrep is installed).

  1. The basics, search for all the files with common extension and list their sizes and time of origin
find . -name '*.sh'  -exec ls -lht  {} \; 

keep in mind just “*” is enough for global search, “.” in find it’s a non-special character

What if you want to copy those files to a new folder?

find  BlastNT/ -iname "*sb" -print -exec  cp {}  ~/GS21/BLAST_DB/ \;
  1. Grep inside a file providing the name of the file
find . -name '*.txt' -exec grep -H "perl \-ne"  {} \;

Bask parallelizing 101:

Measuring excecution time

check execution time of process whose id is known

ps -p 16337 -o etime

Forks and CPUs work distribution

Parallel

Soft and Hard links (ln)

A hard link acts as a copy (mirrored) of the selected file, while soft or symbolic links acts as a pointer or a reference to the file name, however keep in mind, deleting a pointer is also deleting the original folder. A situation taht does not happen with hard links.

Creating comands on Bash

  • Save routinary functions and alias as bash commands with the label you want to use it for them on the terminal. To start, what we need it’s edit the file ~/.bashrc with your favorite text editor, in my case Vim ((guide for vim commands)). The difference between alias and the functions is mainly that the functions read arguments, while alias not. My favorite list of alias and functions on .bashrc file
  • Alias
# List the files in human readble format withut writing -lh and
# organize them by size, from bigger to smaller
alias lso='ls -lh  --sort=size'

# List the files in human readble format withut writing -lh and 
# organize them by time of modification, from sooner to later 
alias lst='ls -lh  --sort=time'

# Delete the files but asking first if that's what you really want 
alias rm='rm -i'
# anyway rm -f would delete without asking, but it requires from you an extra
# time thinking 

# I usually work on servers, I do not like to write ssh hostname@server thousands of time
alias msuhpc=' ssh -X USER@SERVER'

# First time on the matrix? sometimes is hard to know if you are working on a screen session 

alias iscreen=' echo $TERM ' 

# If you are on a server always work on screens, if you lose connection, the screens nope, 
# but outside the matrix, the world is harder. 

# Again an useful alias when you do not want to be kick out from the server, but you are not
# mentally there 

alias waste_time='for f in {1..200}; do echo ------ wasting time minutes $f;  sleep 60; done'
  • Functions

Alias are boring, but save time. Functions are quite interesting, they are basically mini software and bash allow you to create commnads as variated as a blast of a sequence you want to test against blast databases.

# LiSt the Absolut path Directory of a file 
lsad() {
find $PWD -iname $1
}

# List the size of a folder
lsf(){
du -ch --max-depth=0  $1
}

# Search on history a past command 
hisgrep() {
history | grep $1
}

# What if you use a file many times and the previous command shows many boring history
# You can also check only when the file you are interested in was generated 
hisgrep_gen() {
hisgrep "-P \>\\s+$1"
}

# That's all for today darling screen 
delete_screen() {
screen -X -S $1 quit
}


# Adjust the title of a paper to my format of saving it 
papers() {
        final=`echo "$1" | tr '\n' '_' | tr -d '' |tr ' ' '_' | tr -d ',' |tr -d ':' | tr -d '(' | tr -d ')' | tr '/' '-' | awk -F '_$' '{gsub("__","_",$1);print $1}' | awk -F '_$' '{print $1}' `
echo $2.$final
}

# How many nucleotides do a sequence has
count_nt() {
seq=`echo -ne $1 | wc -c`
echo $seq nucleotides
}

# Get the reverse complementary sequence of a 
revcom() {
 if [ "$1" == "DNA" ]
 then
 echo $2 | rev | tr 'ACGTacgt' 'TGCAtgca'
 elif [ "$1" == "RNA" ]
 then
 echo $2 | rev | tr 'ACGUacgu' 'UGCAugca'
 fi
 }

# Check how large is the load of a server
server_status() {
ssh server free -h
ssh server  ps aux --sort=-pcpu | egrep -v "root" | head # add any annoying software always coming up from ps 
ssh server  ps aux --sort=-pcpu   | awk 'NR>1{sum+=$3;sum2+=$4}END{print "Cores used "sum "% and RAM used "sum2" %"}'
}

# Search in a given directory a file by its pattern
reference(){
pattern=`echo $1`
find $2 -iname "*$pattern*"  -print 2>/dev/null 
}

# Search a word in a pdf o thousands of pdfs on a common directory or a single file
# Of course it does requires the installation of pdfgrep
intext(){
find "$1" -name '*pdf' -exec pdfgrep -i "$2" /dev/null {} \; 2>/dev/null
}

These newly defined codes can be used even into common scripts, but first it requires installation:

source ~/.bashrc

To running here, I need to use these commands into scripts, and then you must use the -i parameter, which means:

-i If the -i option is present, the shell is interactive.

Let’s see an example, tell me computer how looks the reverse complementary sequence of ACCCCGAGACTAGGTAGAGACA and how many nucleotides are there?:

This is how looks the script for this:

head BASH/running_bashrc.sh
## 
## revcom DNA ACCCCGAGACTAGGTAGAGACA
## 
## count_nt ACCCCGAGACTAGGTAGAGACA

… And here the output:

bash BASH/running_bashrc.sh

Perl

Perl engulf awk in its language evolutionary history,

Oneliners or -ne command

In previous sections I’ve already shown how versatile is perl’s regrex, using them with grep or the ones shared between perl and awk, however if we want to manipulate a file and not only detect, the most precise way before running into formatting-scripts is the use of perl oneliners. The next example shows a perl one-liner script with a economic writing or non-strict style, starting with:

  1. chomp $_, dispensable but used to remove the last trailing newline from the input string.
  2. @F = split /\t/, $_ , feed the environment array F with each part of the text separated by tab or any other character.
  3. if ($N[1] ne "hsaP-") {$F[3] =~ s/(hsaP)[a-z].*-([let|mir].*)/$1-$2/; control structure, restricting the substitution to only those entries with different name to “hsaP-”
  4. $string=join ("\t", @F); print "$string\n";}, re join split and modified fields and close control structure.

Search and modify in a specific column

echo -ne "chr1\t115215\t115320\ttesting-syntax_hsaPmmu-mir-23a\nchr1\t115215\t115320\ttesting-syntax_hsaP-let-23a\n-Previous to perl edition-\n" 
tail -n 1 Perl/oneliner_search-replace.sh
## chr1 115215  115320  testing-syntax_hsaPmmu-mir-23a
## chr1 115215  115320  testing-syntax_hsaP-let-23a
## -Previous to perl edition-
## perl -ne 'chomp($_); @F = split /\t/, $_; @N = split /_/, $F[3]; if ($N[1] ne "hsaP-") {$F[3] =~ s/(hsaP)[a-z].*-([let|mir].*)/$1-$2/; $string=join ("\t", @F); print "$string\n";}'
bash Perl/oneliner_search-replace.sh 
## chr1 115215  115320  testing-syntax_hsaP-mir-23a
## chr1 115215  115320  testing-syntax_hsaP-let-23a

Search and save multiple hits in a single line

NCBI headers zcat TAIR10.1_cds.ol.fa.gz | grep “protein_id=” | perl -ne ’ $_ =~ s/TAIR:([a-zA-Z0-9]++)].*protein_id=([a-zA-Z0-9]++.[0-9])/$1/; print $1.”.$2.”“;’ | sort | uniq > TAIRid2Uniprot.txt

Pop for cleaning multiple separators inside a single column

It’s quite often I use “_” to differentiate, annotate or provide depper detail for a given entry, however usually, this would be added in addition to previous uses of the same character, as in the next example:

echo -ne "MH899121.1_ALV1.2\nNC_001557.1_TMVsat\n"  
grep -oP "perl.*" Perl/reduce_delimeters.sh 
## MH899121.1_ALV1.2
## NC_001557.1_TMVsat
## perl -ne 'chomp($_);  @F = split /_/, $_;  $last = pop(@F) ; $new = join("_",@F); $new =~ s/_// ; print $new."_".$last."\n";'

In this example there is an entry with double “_” as name, NC_001557.1_TMVsat however the initial one have nothing to do with the second use of it, introducing complexities to the format, a way to remove is by using pop perl function which takes off the last element of an array.

bash Perl/reduce_delimeters.sh
## MH899121.1_ALV1.2
## NC001557.1_TMVsat

Note the perl oneliner delete the first “” while conserving the indicative function of the second ”

Search until

grep “*” true_adapter_r.fa.clstr | grep -Po “>.+?(?=.)”

R

Using grepl to merge dataframes

  1. Using collapsed search terms
merge_criteria <- paste(gsub(pattern = " ", replacement = "", gene_main_interest$TAIR),collapse ="|")
CaMV_Mock_GSE36457_interest <- CaMV_Mock_GSE36457[grepl(ignore.case = T, merge_criteria, CaMV_Mock_GSE36457$AGI.CODE),]

The previous command it’s different to merge R function, in the sense taht tolerates strings variations

exact_match <- merge(CaMV_Mock_GSE36457,gene_main_interest, by.x = "AGI.CODE", by.y = "TAIR", all.y = T)
# Comparing two dataframes 
CaMV_Mock_GSE36457_interest$AGI.CODE[! CaMV_Mock_GSE36457_interest$AGI.CODE %in% exact_match$AGI.CODE]
  1. Using grepl in a for loop
# First generate a Null entry to keep track of those unmatched features 
 CaMV_Mock_GSE36457 [ nrow(CaMV_Mock_GSE36457) + 1 , ] <- NA 
 empty_raw <- CaMV_Mock_GSE36457[nrow(CaMV_Mock_GSE36457),]
# Call the DF to generate the output fist and feed it with both match and unmatched queries
CaMV_Mock_GSE36457_interest <- NULL 
for (f in gene_main_interest$TAIR) {
   g <- CaMV_Mock_GSE36457[grepl(ignore.case = T, f, CaMV_Mock_GSE36457$AGI.CODE),]
   h <- gene_main_interest[grepl(ignore.case = T, f, gene_main_interest$TAIR),]
   if(nrow(g)>0){
   i <- data.frame(h,g)
   } else {
   i <- data.frame(h, empty_raw)   
   }
   CaMV_Mock_GSE36457_interest <- rbind(CaMV_Mock_GSE36457_interest, i)
 }

Multiple substitutions

mgsub <- function(pattern, replacement, x, ...) {
  if (length(pattern)!=length(replacement)) {
    stop("pattern and replacement do not have the same length.")
  }
  result <- x
  for (i in 1:length(pattern)) {
    result <- gsub(pattern[i], replacement[i], result, ...)
  }
  result
}

GitHub

Reconnecting from a new repository

Pushing to github with ssh-authentication

The current project was syncronized by this method using the command

git config remote.origin.url [email protected]:AimerGDiaz/Codes_Repository

Reconnecting in windows

Install first git and configure github account using github credentials.

git config --global user.name AimerGDiaz 
git config --global user.email [email protected] 

New connections in MSU server

In case of need follow github guide: * Generating SSH keys * Genereting .pub pair in github

# Generate git.pub in conventional .ssh folder, copy its content into github ssh keys
# BE Aware of not overwrite  previous rsa  !!
ssh-keygen -t ed25519 -C [email protected] -f ~/.ssh/git 
# Write the actual password for login there 
# Go to github settings and open a new ssh key using the  content of .pub document previuosly created

#Tesdt key funcion by 
 ssh  -T [email protected] 
 
module load GCCcore/12.2.0
# To initialize a new Git repository in the current directory, use:
git init 

git remote add origin [email protected]:AimerGDiaz/UPSC_Riboseq

git config remote.origin.url [email protected]:USER/REPO
git config --global user.name USER
git config --global user.email MAIL

# Same time write .ssh/config file with 
Host github.com
  HostName github.com
  User git
  IdentityFile ~/.ssh/.git
  IdentitiesOnly yes

# DOwnload what is already on the repo
git fetch origin 

git pull origin main
# Let's start to switching branch, from master to main
git branch main 
git checkout main
git fetch origin
git pull origin main

# Ready to fill 
git add .
git commit -m "Welcome MSU"
git push -u origin main

License

My codes are licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.

License: CC BY-NC 4.0

Viewers

Image of Viewers

About

Selection of codes in bash, awk, perl and R

Resources

Stars

0 stars

Watchers

1 watching

Forks

Releases

Packages

Contributors

Languages